Uncategorized

April 29, 2020

Homotypic fusion of yeast vacuolar vesicles

In the assay for the homotypic fusion of yeast vacuolar vesicles it was necessary to incubate the vesicles from two strains with NSF and ATP before they were mixed together. If they were not pre-treated in this way, the vesicles would not fuse. Why do you suppose that step was […]
April 29, 2020

Solution-Which pair has the highest degree of nucleotide

1. Short regions of DNA sequence from four different organisms are shown below. Organism A         AGGTAAGTTACATTTGCAAGCTCTATTGACGCCCOrganism B         AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCCOrganism C         AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCCOrganism D         AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC Here are the same sequences aligned below for you to highlight their differences in sequence: A) […]
April 29, 2020

Solution-About cell theory concept-define the mitochondrial

1. __________   is the fundamental structural and  __________      unit of all living organisms a. cell, functional b. cell, microscopic c. nucleus, functional d. DNA, microscopic 2. Match the scientists with their respective discoveries orderly:  Anton Von Leuvenhock, Robert Brown, Schleider and Schwann,  Singer and Nicolson a. Cell theory, fluid mosaic […]
April 29, 2020

Draw an activation energy diagram

Question: Enzymes are typically needed to catalyze reactions that would be very unlikely to occur on their own. Imagine that the activation energy, Ea, for the uncatalyzed cheese reaction at 20C is 18kcal/mol. This reaction could then be catalyzed by colloidial platinum Ea= 13kcal/mol or by the enzyme renin Ea=7kcal/mol. Draw […]
Prev page
123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566676869707172737475767778798081828384858687888990919293949596979899100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132133134135136137138139140141142143144145146147148149150151152153154155156157158159160161162163164165166167168169170171172173174175176177178179180181182183184185186187188189190191192193194195196197198199200201202203204205206207208209210211212213214215216217218219220221222223224225226227228229230231232233234235236237238239240241242243244245246247248249250251252253254255256257258259260261262263264265266267268269270271272273274275276277278279280281282283284285286287288289290291292293294295296297298299300301302303304305306307308309310311312313314315316317318319320321322323324325326327328329330331332333334335336337338339340341342343344345346347348349350351352353354355356357358359360361362363364365366367368369370371372373374375376377378379380381382383384385386387388389390391392393394395396397398399400401402403404405406407408409410411412413414415416417418419420421422423424425426427428429430431432433434435436437438439440441442443444445446447448449450451452453454455456457458459460461462463464465466467468469470471472473474475476477478479480481482483484485486487488489490491492493494495496497498499500501502503504505506507508509510511512513514515516517518519520521522523524525526527528529530531532533534535536537538539540541542543544545546547548549550551552553554555556557558559560561562563564565566567568569570571572573574575576577578579580581582583584585586587588589590591592593594595596597598599600601602603604605606607608609610611612613614615616617618619620621622623624625626627628629630631632633634635636637638639640641642643644645646647648649650651652653654655656657658659660661662663664665666667668669670671672673674675676677678679680681682683684685686687688689690691692693694695696697698699700701702703704705706707708709710711712713714715716717718719720721722723724725726727728729730731732733734735736737738739740741742743744745746747748749750751752753754755756757758759760761762763764765766767768769770771772773774775776777778779780781782783784785786787788789790791792793794795796797798799800801802803804805806807808809810811812813814815816817818819820821822823824825826827828829830831832833834835836837838839840841842843844845846847848849850851852853854855856857858859860861862863864865866867868869870871872873874875876877878879880881882883884885886887888889890891892893894895896897898899900901902903904905906907908909910911912913914915916917918919920921922923924925926927928929930931932933934935936937938939940941942943944945946947948949950951952953954955956957958959960961962963964965966967968969970971972973974975976977978979980981982983984985986987988989990991992993994995996997998999100010011002100310041005100610071008100910101011101210131014101510161017101810191020102110221023102410251026102710281029103010311032103310341035103610371038103910401041104210431044104510461047104810491050105110521053105410551056105710581059106010611062106310641065106610671068106910701071107210731074107510761077107810791080108110821083108410851086108710881089109010911092109310941095109610971098109911001101110211031104110511061107110811091110111111121113111411151116111711181119112011211122112311241125112611271128112911301131113211331134113511361137113811391140114111421143114411451146114711481149115011511152115311541155115611571158115911601161116211631164116511661167116811691170117111721173117411751176117711781179118011811182118311841185118611871188118911901191119211931194119511961197119811991200120112021203120412051206120712081209121012111212121312141215121612171218121912201221122212231224122512261227122812291230123112321233123412351236123712381239124012411242124312441245124612471248124912501251125212531254125512561257125812591260126112621263126412651266126712681269127012711272127312741275127612771278127912801281128212831284128512861287128812891290129112921293129412951296129712981299130013011302130313041305130613071308130913101311131213131314131513161317131813191320132113221323132413251326132713281329133013311332133313341335133613371338133913401341134213431344134513461347134813491350135113521353135413551356135713581359136013611362136313641365136613671368136913701371137213731374137513761377137813791380138113821383138413851386138713881389139013911392139313941395139613971398139914001401140214031404140514061407140814091410141114121413141414151416141714181419142014211422142314241425142614271428142914301431143214331434143514361437143814391440144114421443144414451446144714481449145014511452145314541455145614571458145914601461146214631464146514661467146814691470147114721473147414751476147714781479148014811482148314841485148614871488148914901491149214931494149514961497149814991500150115021503150415051506150715081509151015111512151315141515151615171518151915201521152215231524152515261527152815291530153115321533153415351536153715381539154015411542154315441545154615471548154915501551155215531554155515561557155815591560156115621563156415651566156715681569157015711572157315741575157615771578157915801581158215831584158515861587158815891590159115921593159415951596159715981599160016011602160316041605160616071608160916101611161216131614161516161617161816191620162116221623162416251626162716281629163016311632163316341635163616371638163916401641164216431644164516461647164816491650165116521653165416551656165716581659166016611662166316641665166616671668166916701671167216731674167516761677167816791680168116821683168416851686168716881689169016911692169316941695169616971698169917001701170217031704170517061707170817091710171117121713171417151716171717181719172017211722172317241725172617271728172917301731173217331734173517361737173817391740174117421743174417451746174717481749175017511752175317541755175617571758175917601761176217631764176517661767176817691770177117721773177417751776177717781779178017811782178317841785178617871788178917901791179217931794179517961797179817991800180118021803180418051806180718081809181018111812181318141815181618171818181918201821182218231824182518261827182818291830183118321833183418351836183718381839184018411842184318441845184618471848184918501851185218531854185518561857185818591860186118621863186418651866186718681869187018711872187318741875187618771878187918801881188218831884188518861887188818891890189118921893189418951896189718981899190019011902190319041905190619071908190919101911191219131914191519161917191819191920192119221923192419251926192719281929193019311932193319341935193619371938193919401941194219431944194519461947194819491950195119521953195419551956195719581959196019611962196319641965196619671968196919701971197219731974197519761977197819791980198119821983198419851986198719881989199019911992199319941995199619971998199920002001200220032004200520062007200820092010201120122013201420152016201720182019202020212022202320242025202620272028202920302031203220332034203520362037203820392040204120422043204420452046204720482049205020512052205320542055205620572058205920602061206220632064206520662067206820692070207120722073207420752076207720782079208020812082208320842085208620872088208920902091209220932094209520962097209820992100210121022103210421052106210721082109211021112112211321142115211621172118211921202121212221232124212521262127212821292130213121322133213421352136213721382139214021412142214321442145214621472148214921502151215221532154215521562157215821592160216121622163216421652166216721682169217021712172217321742175217621772178217921802181218221832184218521862187218821892190219121922193219421952196219721982199220022012202220322042205220622072208220922102211221222132214221522162217221822192220222122222223222422252226222722282229223022312232223322342235223622372238223922402241224222432244224522462247224822492250225122522253225422552256225722582259226022612262226322642265226622672268226922702271227222732274227522762277227822792280228122822283228422852286228722882289229022912292229322942295229622972298229923002301230223032304230523062307230823092310231123122313231423152316231723182319232023212322232323242325232623272328232923302331233223332334233523362337233823392340234123422343234423452346234723482349235023512352235323542355235623572358235923602361236223632364236523662367236823692370237123722373237423752376237723782379238023812382238323842385238623872388238923902391239223932394239523962397239823992400240124022403240424052406240724082409241024112412241324142415241624172418241924202421242224232424242524262427242824292430243124322433243424352436243724382439244024412442244324442445244624472448244924502451245224532454245524562457245824592460246124622463246424652466246724682469247024712472247324742475247624772478247924802481248224832484248524862487248824892490249124922493249424952496249724982499250025012502250325042505250625072508250925102511251225132514251525162517251825192520252125222523252425252526252725282529253025312532253325342535253625372538253925402541254225432544254525462547254825492550255125522553255425552556255725582559256025612562256325642565256625672568256925702571257225732574257525762577257825792580258125822583258425852586258725882589259025912592259325942595259625972598259926002601260226032604260526062607260826092610261126122613261426152616261726182619262026212622262326242625262626272628262926302631263226332634263526362637263826392640264126422643264426452646264726482649265026512652265326542655265626572658265926602661266226632664266526662667266826692670267126722673267426752676267726782679268026812682268326842685268626872688268926902691269226932694269526962697269826992700270127022703270427052706270727082709271027112712271327142715271627172718271927202721272227232724272527262727272827292730273127322733273427352736273727382739274027412742274327442745274627472748274927502751275227532754275527562757275827592760276127622763276427652766276727682769277027712772277327742775277627772778277927802781278227832784278527862787278827892790279127922793279427952796279727982799280028012802280328042805280628072808280928102811281228132814281528162817281828192820282128222823282428252826282728282829283028312832283328342835283628372838283928402841284228432844284528462847284828492850285128522853285428552856285728582859286028612862286328642865286628672868286928702871287228732874287528762877287828792880288128822883288428852886288728882889289028912892289328942895289628972898289929002901290229032904290529062907290829092910291129122913291429152916291729182919292029212922292329242925292629272928292929302931293229332934293529362937293829392940294129422943294429452946294729482949295029512952295329542955295629572958295929602961296229632964296529662967296829692970297129722973297429752976297729782979298029812982298329842985298629872988298929902991299229932994299529962997299829993000300130023003300430053006300730083009301030113012301330143015301630173018301930203021302230233024302530263027302830293030303130323033303430353036303730383039304030413042304330443045304630473048304930503051305230533054305530563057305830593060306130623063306430653066306730683069307030713072307330743075307630773078307930803081308230833084308530863087308830893090309130923093309430953096309730983099310031013102310331043105310631073108310931103111311231133114311531163117311831193120312131223123312431253126312731283129313031313132313331343135313631373138313931403141314231433144314531463147314831493150315131523153315431553156315731583159316031613162316331643165316631673168316931703171317231733174317531763177317831793180318131823183318431853186318731883189319031913192319331943195319631973198319932003201320232033204320532063207320832093210321132123213321432153216321732183219322032213222322332243225322632273228322932303231323232333234323532363237323832393240324132423243324432453246324732483249325032513252325332543255325632573258325932603261326232633264326532663267326832693270327132723273327432753276327732783279328032813282328332843285328632873288328932903291329232933294329532963297329832993300330133023303330433053306330733083309331033113312331333143315331633173318331933203321332233233324332533263327332833293330333133323333333433353336333733383339334033413342334333443345334633473348334933503351335233533354335533563357335833593360336133623363336433653366336733683369337033713372337333743375337633773378337933803381338233833384338533863387338833893390339133923393339433953396339733983399340034013402340334043405340634073408340934103411341234133414341534163417341834193420342134223423342434253426342734283429343034313432343334343435343634373438343934403441344234433444344534463447344834493450345134523453345434553456345734583459346034613462346334643465346634673468346934703471347234733474347534763477347834793480348134823483348434853486348734883489349034913492349334943495349634973498349935003501350235033504350535063507350835093510351135123513351435153516351735183519352035213522352335243525352635273528352935303531353235333534353535363537353835393540354135423543354435453546354735483549355035513552355335543555355635573558355935603561356235633564356535663567356835693570357135723573357435753576357735783579358035813582358335843585358635873588358935903591359235933594359535963597359835993600360136023603360436053606360736083609361036113612361336143615361636173618361936203621362236233624362536263627362836293630363136323633363436353636363736383639364036413642364336443645364636473648364936503651365236533654365536563657365836593660366136623663366436653666366736683669367036713672367336743675367636773678367936803681368236833684368536863687368836893690369136923693369436953696369736983699370037013702370337043705370637073708370937103711371237133714371537163717371837193720372137223723372437253726372737283729373037313732373337343735373637373738373937403741374237433744374537463747374837493750375137523753375437553756375737583759376037613762376337643765376637673768376937703771377237733774377537763777377837793780378137823783378437853786378737883789379037913792379337943795379637973798379938003801380238033804380538063807380838093810381138123813381438153816381738183819382038213822382338243825382638273828382938303831383238333834383538363837383838393840384138423843384438453846384738483849385038513852385338543855385638573858385938603861386238633864386538663867386838693870387138723873387438753876387738783879388038813882388338843885388638873888388938903891389238933894389538963897389838993900390139023903390439053906390739083909391039113912391339143915391639173918391939203921392239233924392539263927392839293930393139323933393439353936393739383939394039413942394339443945394639473948394939503951395239533954395539563957395839593960396139623963396439653966396739683969397039713972397339743975397639773978397939803981398239833984398539863987398839893990399139923993399439953996399739983999400040014002400340044005400640074008400940104011401240134014401540164017401840194020402140224023402440254026402740284029403040314032403340344035403640374038403940404041404240434044404540464047404840494050405140524053405440554056405740584059406040614062406340644065406640674068406940704071407240734074407540764077407840794080408140824083408440854086408740884089409040914092409340944095409640974098409941004101410241034104410541064107410841094110411141124113411441154116411741184119412041214122412341244125412641274128412941304131413241334134413541364137413841394140414141424143414441454146414741484149415041514152415341544155415641574158415941604161416241634164416541664167416841694170417141724173417441754176417741784179418041814182418341844185418641874188418941904191419241934194419541964197419841994200420142024203420442054206420742084209421042114212421342144215421642174218421942204221422242234224422542264227422842294230423142324233423442354236423742384239424042414242424342444245424642474248424942504251425242534254425542564257425842594260426142624263426442654266426742684269427042714272427342744275427642774278427942804281428242834284428542864287428842894290429142924293429442954296429742984299430043014302430343044305430643074308430943104311431243134314431543164317431843194320432143224323432443254326432743284329433043314332433343344335433643374338433943404341434243434344434543464347434843494350435143524353435443554356435743584359436043614362436343644365436643674368436943704371437243734374437543764377437843794380438143824383438443854386438743884389439043914392439343944395439643974398439944004401440244034404440544064407440844094410441144124413441444154416441744184419442044214422442344244425442644274428442944304431443244334434443544364437443844394440444144424443444444454446444744484449445044514452445344544455445644574458445944604461446244634464446544664467446844694470447144724473447444754476447744784479448044814482448344844485448644874488448944904491449244934494449544964497449844994500450145024503450445054506450745084509451045114512451345144515451645174518451945204521452245234524452545264527452845294530453145324533453445354536453745384539454045414542454345444545454645474548454945504551455245534554455545564557455845594560456145624563456445654566456745684569457045714572457345744575457645774578457945804581458245834584458545864587458845894590459145924593459445954596459745984599460046014602460346044605460646074608460946104611461246134614461546164617461846194620462146224623462446254626462746284629463046314632463346344635463646374638463946404641464246434644464546464647464846494650465146524653465446554656465746584659466046614662466346644665466646674668466946704671467246734674467546764677467846794680468146824683468446854686468746884689469046914692469346944695469646974698469947004701470247034704470547064707470847094710471147124713471447154716471747184719472047214722472347244725472647274728472947304731473247334734473547364737473847394740474147424743474447454746474747484749475047514752475347544755475647574758475947604761476247634764476547664767476847694770477147724773477447754776477747784779478047814782478347844785478647874788478947904791479247934794479547964797479847994800480148024803480448054806480748084809481048114812481348144815481648174818481948204821482248234824482548264827482848294830483148324833483448354836483748384839484048414842484348444845484648474848484948504851485248534854485548564857485848594860486148624863486448654866486748684869487048714872487348744875487648774878487948804881488248834884488548864887488848894890489148924893489448954896489748984899490049014902490349044905490649074908490949104911491249134914491549164917491849194920492149224923492449254926492749284929493049314932493349344935493649374938493949404941494249434944494549464947494849494950495149524953495449554956495749584959496049614962496349644965496649674968496949704971497249734974497549764977497849794980498149824983498449854986498749884989499049914992499349944995499649974998499950005001500250035004500550065007500850095010501150125013501450155016501750185019502050215022502350245025502650275028502950305031503250335034503550365037503850395040504150425043504450455046504750485049505050515052505350545055505650575058505950605061506250635064506550665067506850695070507150725073507450755076507750785079508050815082508350845085508650875088508950905091509250935094509550965097509850995100510151025103510451055106510751085109511051115112511351145115511651175118511951205121512251235124512551265127512851295130513151325133513451355136513751385139514051415142514351445145514651475148514951505151515251535154515551565157515851595160516151625163516451655166516751685169517051715172517351745175517651775178517951805181518251835184518551865187518851895190519151925193519451955196519751985199520052015202520352045205520652075208520952105211521252135214521552165217521852195220522152225223522452255226522752285229523052315232523352345235523652375238523952405241524252435244524552465247524852495250525152525253525452555256525752585259526052615262526352645265526652675268526952705271527252735274527552765277527852795280528152825283528452855286528752885289529052915292529352945295529652975298529953005301530253035304530553065307530853095310531153125313531453155316531753185319532053215322532353245325532653275328532953305331533253335334533553365337533853395340534153425343534453455346534753485349535053515352535353545355535653575358535953605361536253635364536553665367536853695370537153725373537453755376537753785379538053815382538353845385538653875388538953905391539253935394539553965397539853995400540154025403540454055406540754085409541054115412541354145415541654175418541954205421542254235424542554265427542854295430543154325433543454355436543754385439544054415442544354445445544654475448544954505451545254535454545554565457545854595460546154625463546454655466546754685469547054715472547354745475547654775478547954805481548254835484548554865487548854895490549154925493549454955496549754985499550055015502550355045505550655075508550955105511551255135514551555165517551855195520552155225523552455255526552755285529553055315532553355345535553655375538553955405541554255435544554555465547554855495550555155525553555455555556555755585559556055615562556355645565556655675568556955705571557255735574557555765577557855795580558155825583558455855586558755885589559055915592559355945595559655975598559956005601560256035604560556065607560856095610561156125613561456155616561756185619562056215622562356245625562656275628562956305631563256335634563556365637563856395640564156425643564456455646564756485649565056515652565356545655565656575658565956605661566256635664566556665667566856695670567156725673567456755676567756785679568056815682568356845685568656875688568956905691569256935694569556965697569856995700570157025703570457055706570757085709571057115712571357145715571657175718571957205721572257235724572557265727572857295730573157325733573457355736573757385739574057415742574357445745574657475748574957505751575257535754575557565757575857595760576157625763576457655766576757685769577057715772577357745775577657775778577957805781578257835784578557865787578857895790579157925793579457955796579757985799580058015802580358045805580658075808580958105811581258135814581558165817581858195820582158225823582458255826582758285829583058315832583358345835583658375838583958405841584258435844584558465847584858495850585158525853585458555856585758585859586058615862586358645865586658675868586958705871587258735874587558765877587858795880588158825883588458855886588758885889589058915892589358945895589658975898589959005901590259035904590559065907590859095910591159125913591459155916591759185919592059215922592359245925592659275928592959305931593259335934593559365937593859395940594159425943594459455946594759485949595059515952595359545955595659575958595959605961596259635964596559665967596859695970597159725973597459755976597759785979598059815982598359845985598659875988598959905991599259935994599559965997599859996000600160026003600460056006600760086009601060116012601360146015601660176018601960206021602260236024602560266027602860296030603160326033603460356036603760386039604060416042604360446045604660476048604960506051605260536054605560566057605860596060606160626063606460656066606760686069607060716072607360746075607660776078607960806081608260836084608560866087608860896090609160926093609460956096609760986099610061016102610361046105610661076108610961106111611261136114611561166117611861196120612161226123612461256126612761286129613061316132613361346135613661376138613961406141614261436144614561466147614861496150615161526153615461556156615761586159616061616162616361646165616661676168616961706171617261736174617561766177617861796180618161826183618461856186618761886189619061916192619361946195619661976198619962006201620262036204620562066207620862096210621162126213621462156216621762186219622062216222622362246225622662276228622962306231623262336234623562366237623862396240624162426243624462456246624762486249625062516252625362546255625662576258625962606261626262636264626562666267626862696270627162726273627462756276627762786279628062816282628362846285628662876288628962906291629262936294629562966297629862996300630163026303630463056306630763086309631063116312631363146315631663176318631963206321632263236324632563266327632863296330633163326333633463356336633763386339634063416342634363446345634663476348634963506351635263536354635563566357635863596360636163626363636463656366636763686369637063716372637363746375637663776378637963806381638263836384638563866387638863896390639163926393639463956396639763986399640064016402640364046405640664076408640964106411641264136414641564166417641864196420642164226423642464256426642764286429643064316432643364346435643664376438643964406441644264436444644564466447644864496450645164526453645464556456645764586459646064616462646364646465646664676468646964706471647264736474647564766477647864796480648164826483648464856486648764886489649064916492649364946495649664976498649965006501650265036504650565066507650865096510651165126513651465156516651765186519652065216522652365246525652665276528652965306531653265336534653565366537653865396540654165426543654465456546654765486549655065516552655365546555655665576558655965606561656265636564656565666567656865696570657165726573657465756576657765786579658065816582658365846585658665876588658965906591659265936594659565966597659865996600660166026603660466056606660766086609661066116612661366146615661666176618661966206621662266236624662566266627662866296630663166326633663466356636663766386639664066416642664366446645664666476648664966506651665266536654665566566657665866596660666166626663666466656666666766686669667066716672667366746675667666776678667966806681668266836684668566866687668866896690669166926693669466956696669766986699670067016702670367046705670667076708670967106711671267136714671567166717671867196720672167226723672467256726672767286729673067316732673367346735673667376738673967406741674267436744674567466747674867496750675167526753675467556756675767586759676067616762676367646765676667676768676967706771677267736774677567766777677867796780678167826783678467856786678767886789679067916792679367946795679667976798679968006801680268036804680568066807680868096810681168126813681468156816681768186819682068216822682368246825682668276828682968306831683268336834683568366837683868396840684168426843684468456846684768486849685068516852685368546855685668576858685968606861686268636864686568666867686868696870687168726873687468756876687768786879688068816882688368846885688668876888688968906891689268936894689568966897689868996900690169026903690469056906690769086909691069116912691369146915691669176918691969206921692269236924692569266927692869296930693169326933693469356936693769386939694069416942694369446945694669476948694969506951695269536954695569566957695869596960696169626963696469656966696769686969697069716972697369746975697669776978697969806981698269836984698569866987698869896990699169926993699469956996699769986999700070017002700370047005700670077008700970107011701270137014701570167017701870197020702170227023702470257026702770287029703070317032703370347035703670377038703970407041704270437044704570467047704870497050705170527053705470557056705770587059706070617062706370647065706670677068706970707071707270737074707570767077707870797080708170827083708470857086708770887089709070917092709370947095709670977098709971007101710271037104710571067107710871097110711171127113711471157116711771187119712071217122712371247125712671277128712971307131713271337134713571367137713871397140714171427143714471457146714771487149715071517152715371547155715671577158715971607161716271637164716571667167716871697170717171727173717471757176717771787179718071817182718371847185718671877188718971907191719271937194719571967197719871997200720172027203720472057206720772087209721072117212721372147215721672177218721972207221722272237224722572267227722872297230723172327233723472357236723772387239724072417242724372447245724672477248724972507251725272537254725572567257725872597260726172627263726472657266726772687269727072717272727372747275727672777278727972807281728272837284728572867287728872897290729172927293729472957296729772987299730073017302730373047305730673077308730973107311731273137314731573167317731873197320732173227323732473257326732773287329733073317332733373347335733673377338733973407341734273437344734573467347734873497350735173527353735473557356735773587359736073617362736373647365736673677368736973707371737273737374737573767377737873797380738173827383738473857386738773887389739073917392739373947395739673977398739974007401740274037404740574067407740874097410741174127413741474157416741774187419742074217422742374247425742674277428742974307431743274337434743574367437743874397440744174427443744474457446744774487449745074517452745374547455745674577458745974607461746274637464746574667467746874697470747174727473747474757476747774787479748074817482748374847485748674877488748974907491749274937494749574967497749874997500750175027503750475057506750775087509751075117512751375147515751675177518751975207521752275237524752575267527752875297530753175327533753475357536753775387539754075417542754375447545754675477548754975507551755275537554755575567557755875597560756175627563756475657566756775687569757075717572757375747575757675777578757975807581758275837584758575867587758875897590759175927593759475957596759775987599760076017602760376047605760676077608760976107611761276137614761576167617761876197620762176227623762476257626762776287629763076317632763376347635763676377638763976407641764276437644764576467647764876497650765176527653765476557656765776587659766076617662766376647665766676677668766976707671767276737674767576767677767876797680768176827683768476857686768776887689769076917692769376947695769676977698769977007701770277037704770577067707770877097710771177127713771477157716771777187719772077217722772377247725772677277728772977307731773277337734773577367737773877397740774177427743774477457746774777487749775077517752775377547755775677577758775977607761776277637764776577667767776877697770777177727773777477757776777777787779778077817782778377847785778677877788778977907791779277937794779577967797779877997800780178027803780478057806780778087809781078117812781378147815781678177818781978207821782278237824782578267827782878297830783178327833783478357836783778387839784078417842784378447845784678477848784978507851785278537854785578567857785878597860786178627863786478657866786778687869787078717872787378747875787678777878787978807881788278837884788578867887788878897890789178927893789478957896789778987899790079017902790379047905790679077908790979107911791279137914791579167917791879197920792179227923792479257926792779287929793079317932793379347935793679377938793979407941794279437944794579467947794879497950795179527953795479557956795779587959796079617962796379647965796679677968796979707971797279737974797579767977797879797980798179827983798479857986798779887989799079917992799379947995799679977998799980008001800280038004800580068007800880098010801180128013801480158016801780188019802080218022802380248025802680278028802980308031803280338034803580368037803880398040804180428043804480458046804780488049805080518052805380548055805680578058805980608061806280638064806580668067806880698070807180728073807480758076807780788079808080818082808380848085808680878088808980908091809280938094809580968097809880998100810181028103810481058106810781088109811081118112811381148115811681178118811981208121812281238124812581268127812881298130813181328133813481358136813781388139814081418142814381448145814681478148814981508151815281538154815581568157815881598160816181628163816481658166816781688169817081718172817381748175817681778178817981808181818281838184818581868187818881898190819181928193819481958196819781988199820082018202820382048205820682078208820982108211821282138214821582168217821882198220822182228223822482258226822782288229823082318232823382348235823682378238823982408241824282438244824582468247824882498250825182528253825482558256825782588259826082618262826382648265826682678268826982708271827282738274827582768277827882798280828182828283828482858286828782888289829082918292829382948295829682978298829983008301830283038304830583068307830883098310831183128313831483158316831783188319832083218322832383248325832683278328832983308331833283338334833583368337833883398340834183428343834483458346834783488349835083518352835383548355835683578358835983608361836283638364836583668367836883698370837183728373837483758376837783788379838083818382838383848385838683878388838983908391839283938394839583968397839883998400840184028403840484058406840784088409841084118412841384148415841684178418841984208421842284238424842584268427842884298430843184328433843484358436843784388439844084418442844384448445844684478448844984508451845284538454845584568457845884598460846184628463846484658466846784688469847084718472847384748475847684778478847984808481848284838484848584868487848884898490849184928493849484958496849784988499850085018502850385048505850685078508850985108511851285138514851585168517851885198520852185228523852485258526852785288529853085318532853385348535853685378538853985408541854285438544854585468547854885498550855185528553855485558556855785588559856085618562856385648565856685678568856985708571857285738574857585768577857885798580858185828583858485858586858785888589859085918592859385948595859685978598859986008601860286038604860586068607860886098610861186128613861486158616861786188619862086218622862386248625862686278628862986308631863286338634863586368637863886398640864186428643864486458646864786488649865086518652865386548655865686578658865986608661866286638664866586668667866886698670867186728673867486758676867786788679868086818682868386848685868686878688868986908691869286938694869586968697869886998700870187028703870487058706870787088709871087118712871387148715871687178718871987208721872287238724872587268727872887298730873187328733873487358736873787388739874087418742874387448745874687478748874987508751875287538754875587568757875887598760876187628763876487658766876787688769877087718772877387748775877687778778877987808781878287838784878587868787878887898790879187928793879487958796879787988799880088018802880388048805880688078808880988108811881288138814881588168817881888198820882188228823882488258826882788288829883088318832883388348835883688378838883988408841884288438844884588468847884888498850885188528853885488558856885788588859886088618862886388648865886688678868886988708871887288738874887588768877887888798880888188828883888488858886888788888889889088918892889388948895889688978898889989008901890289038904890589068907890889098910891189128913891489158916891789188919892089218922892389248925892689278928892989308931893289338934893589368937893889398940894189428943894489458946894789488949895089518952895389548955895689578958895989608961896289638964896589668967896889698970897189728973897489758976897789788979898089818982898389848985898689878988898989908991899289938994899589968997899889999000900190029003900490059006900790089009901090119012901390149015901690179018901990209021902290239024902590269027902890299030903190329033903490359036903790389039904090419042904390449045904690479048904990509051905290539054905590569057905890599060906190629063906490659066906790689069907090719072907390749075907690779078907990809081908290839084908590869087908890899090909190929093909490959096909790989099910091019102910391049105910691079108910991109111911291139114911591169117911891199120912191229123912491259126912791289129913091319132913391349135913691379138913991409141914291439144914591469147914891499150915191529153915491559156915791589159916091619162916391649165916691679168916991709171917291739174917591769177917891799180918191829183918491859186918791889189919091919192919391949195919691979198919992009201920292039204920592069207920892099210921192129213921492159216921792189219922092219222922392249225922692279228922992309231923292339234923592369237923892399240924192429243924492459246924792489249925092519252925392549255925692579258925992609261926292639264926592669267926892699270927192729273927492759276927792789279928092819282928392849285928692879288928992909291929292939294929592969297929892999300930193029303930493059306930793089309931093119312931393149315931693179318931993209321932293239324932593269327932893299330933193329333933493359336933793389339934093419342934393449345934693479348934993509351935293539354935593569357935893599360936193629363936493659366936793689369937093719372937393749375937693779378937993809381938293839384938593869387938893899390939193929393939493959396939793989399940094019402940394049405940694079408940994109411941294139414941594169417941894199420942194229423942494259426942794289429943094319432943394349435943694379438943994409441944294439444944594469447944894499450945194529453945494559456945794589459946094619462946394649465946694679468946994709471947294739474947594769477947894799480948194829483948494859486948794889489949094919492949394949495949694979498949995009501950295039504950595069507950895099510951195129513951495159516951795189519952095219522952395249525952695279528952995309531953295339534953595369537953895399540954195429543954495459546954795489549955095519552955395549555955695579558955995609561956295639564956595669567956895699570957195729573957495759576957795789579958095819582958395849585958695879588958995909591959295939594959595969597959895999600960196029603960496059606960796089609961096119612961396149615961696179618961996209621962296239624962596269627962896299630963196329633963496359636963796389639964096419642964396449645964696479648964996509651965296539654965596569657965896599660966196629663966496659666966796689669967096719672967396749675967696779678967996809681968296839684968596869687968896899690969196929693969496959696969796989699970097019702970397049705970697079708970997109711971297139714971597169717971897199720972197229723972497259726972797289729973097319732973397349735973697379738973997409741974297439744974597469747974897499750975197529753975497559756975797589759976097619762976397649765976697679768976997709771977297739774977597769777977897799780978197829783978497859786978797889789979097919792979397949795979697979798979998009801980298039804980598069807980898099810981198129813981498159816981798189819982098219822982398249825982698279828982998309831983298339834983598369837983898399840984198429843984498459846984798489849985098519852985398549855985698579858985998609861986298639864986598669867986898699870987198729873987498759876987798789879988098819882988398849885988698879888988998909891989298939894989598969897989898999900990199029903990499059906990799089909991099119912991399149915991699179918991999209921992299239924992599269927992899299930993199329933993499359936993799389939994099419942994399449945994699479948994999509951995299539954995599569957995899599960996199629963996499659966996799689969997099719972997399749975997699779978997999809981998299839984998599869987998899899990999199929993999499959996999799989999100001000110002100031000410005100061000710008100091001010011100121001310014100151001610017100181001910020100211002210023100241002510026100271002810029100301003110032100331003410035100361003710038100391004010041100421004310044100451004610047100481004910050100511005210053100541005510056100571005810059100601006110062100631006410065100661006710068100691007010071100721007310074100751007610077100781007910080100811008210083100841008510086100871008810089100901009110092100931009410095100961009710098100991010010101101021010310104101051010610107101081010910110101111011210113101141011510116101171011810119101201012110122101231012410125101261012710128101291013010131101321013310134101351013610137101381013910140101411014210143101441014510146101471014810149101501015110152101531015410155101561015710158101591016010161101621016310164101651016610167101681016910170101711017210173101741017510176101771017810179101801018110182101831018410185101861018710188101891019010191101921019310194101951019610197101981019910200102011020210203102041020510206102071020810209102101021110212102131021410215102161021710218102191022010221102221022310224102251022610227102281022910230102311023210233102341023510236102371023810239102401024110242102431024410245102461024710248102491025010251102521025310254102551025610257102581025910260102611026210263102641026510266102671026810269102701027110272102731027410275102761027710278102791028010281102821028310284102851028610287102881028910290102911029210293102941029510296102971029810299103001030110302103031030410305103061030710308103091031010311103121031310314103151031610317103181031910320103211032210323103241032510326103271032810329103301033110332103331033410335103361033710338103391034010341103421034310344103451034610347103481034910350103511035210353103541035510356103571035810359103601036110362103631036410365103661036710368103691037010371103721037310374103751037610377103781037910380103811038210383103841038510386103871038810389103901039110392103931039410395103961039710398103991040010401104021040310404104051040610407104081040910410104111041210413104141041510416104171041810419104201042110422104231042410425104261042710428104291043010431104321043310434104351043610437104381043910440104411044210443104441044510446104471044810449104501045110452104531045410455104561045710458104591046010461104621046310464104651046610467104681046910470104711047210473104741047510476104771047810479104801048110482104831048410485104861048710488104891049010491104921049310494104951049610497104981049910500105011050210503105041050510506105071050810509105101051110512105131051410515105161051710518105191052010521105221052310524105251052610527105281052910530105311053210533105341053510536105371053810539105401054110542105431054410545105461054710548105491055010551105521055310554105551055610557105581055910560105611056210563105641056510566105671056810569105701057110572105731057410575105761057710578105791058010581105821058310584105851058610587105881058910590105911059210593105941059510596105971059810599106001060110602106031060410605106061060710608106091061010611106121061310614106151061610617106181061910620106211062210623106241062510626106271062810629106301063110632106331063410635106361063710638106391064010641106421064310644106451064610647106481064910650106511065210653106541065510656106571065810659106601066110662106631066410665106661066710668106691067010671106721067310674106751067610677106781067910680106811068210683106841068510686106871068810689106901069110692106931069410695106961069710698106991070010701107021070310704107051070610707107081070910710107111071210713107141071510716107171071810719107201072110722107231072410725107261072710728107291073010731107321073310734107351073610737107381073910740107411074210743107441074510746107471074810749107501075110752107531075410755107561075710758107591076010761107621076310764107651076610767107681076910770107711077210773107741077510776107771077810779107801078110782107831078410785107861078710788107891079010791107921079310794107951079610797107981079910800108011080210803108041080510806108071080810809108101081110812108131081410815108161081710818108191082010821108221082310824108251082610827108281082910830108311083210833108341083510836108371083810839108401084110842108431084410845108461084710848108491085010851108521085310854108551085610857108581085910860108611086210863108641086510866108671086810869108701087110872108731087410875108761087710878108791088010881108821088310884108851088610887108881088910890108911089210893108941089510896108971089810899109001090110902109031090410905109061090710908109091091010911109121091310914109151091610917109181091910920109211092210923109241092510926109271092810929109301093110932109331093410935109361093710938109391094010941109421094310944109451094610947109481094910950109511095210953109541095510956109571095810959109601096110962109631096410965109661096710968109691097010971109721097310974109751097610977109781097910980109811098210983109841098510986109871098810989109901099110992109931099410995109961099710998109991100011001110021100311004110051100611007110081100911010110111101211013110141101511016110171101811019110201102111022110231102411025110261102711028110291103011031110321103311034110351103611037110381103911040110411104211043110441104511046110471104811049110501105111052110531105411055110561105711058110591106011061110621106311064110651106611067110681106911070110711107211073110741107511076110771107811079110801108111082110831108411085110861108711088110891109011091110921109311094110951109611097110981109911100111011110211103111041110511106111071110811109111101111111112111131111411115111161111711118111191112011121111221112311124111251112611127111281112911130111311113211133111341113511136111371113811139111401114111142111431114411145111461114711148111491115011151111521115311154111551115611157111581115911160111611116211163111641116511166111671116811169111701117111172111731117411175111761117711178111791118011181111821118311184111851118611187111881118911190111911119211193111941119511196111971119811199112001120111202112031120411205112061120711208112091121011211112121121311214112151121611217112181121911220112211122211223112241122511226112271122811229112301123111232112331123411235112361123711238112391124011241112421124311244112451124611247112481124911250112511125211253112541125511256112571125811259112601126111262112631126411265112661126711268112691127011271112721127311274112751127611277112781127911280112811128211283112841128511286112871128811289112901129111292112931129411295112961129711298112991130011301113021130311304113051130611307113081130911310113111131211313113141131511316113171131811319113201132111322113231132411325113261132711328113291133011331113321133311334113351133611337113381133911340113411134211343113441134511346113471134811349113501135111352113531135411355113561135711358113591136011361113621136311364113651136611367113681136911370113711137211373113741137511376113771137811379113801138111382113831138411385113861138711388113891139011391113921139311394113951139611397113981139911400114011140211403114041140511406114071140811409114101141111412114131141411415114161141711418114191142011421114221142311424114251142611427114281142911430114311143211433114341143511436114371143811439114401144111442114431144411445114461144711448114491145011451114521145311454114551145611457114581145911460114611146211463114641146511466114671146811469114701147111472114731147411475114761147711478114791148011481114821148311484114851148611487114881148911490114911149211493114941149511496114971149811499115001150111502115031150411505115061150711508115091151011511115121151311514115151151611517115181151911520115211152211523115241152511526115271152811529115301153111532115331153411535115361153711538115391154011541115421154311544115451154611547115481154911550115511155211553115541155511556115571155811559115601156111562115631156411565115661156711568115691157011571115721157311574115751157611577115781157911580115811158211583115841158511586115871158811589115901159111592115931159411595115961159711598115991160011601116021160311604116051160611607116081160911610116111161211613116141161511616116171161811619116201162111622116231162411625116261162711628116291163011631116321163311634116351163611637116381163911640116411164211643116441164511646116471164811649116501165111652116531165411655116561165711658116591166011661116621166311664116651166611667116681166911670116711167211673116741167511676116771167811679116801168111682116831168411685116861168711688116891169011691116921169311694116951169611697116981169911700117011170211703117041170511706117071170811709117101171111712117131171411715117161171711718117191172011721117221172311724117251172611727117281172911730117311173211733117341173511736117371173811739117401174111742117431174411745117461174711748117491175011751117521175311754117551175611757117581175911760117611176211763117641176511766117671176811769117701177111772117731177411775117761177711778117791178011781117821178311784117851178611787117881178911790117911179211793117941179511796117971179811799118001180111802118031180411805118061180711808118091181011811118121181311814118151181611817118181181911820118211182211823118241182511826118271182811829118301183111832118331183411835118361183711838118391184011841118421184311844118451184611847118481184911850118511185211853118541185511856118571185811859118601186111862118631186411865118661186711868118691187011871118721187311874118751187611877118781187911880118811188211883118841188511886118871188811889118901189111892118931189411895118961189711898118991190011901119021190311904119051190611907119081190911910119111191211913119141191511916119171191811919119201192111922119231192411925119261192711928119291193011931119321193311934119351193611937119381193911940119411194211943119441194511946119471194811949119501195111952119531195411955119561195711958119591196011961119621196311964119651196611967119681196911970119711197211973119741197511976119771197811979119801198111982119831198411985119861198711988119891199011991119921199311994119951199611997119981199912000120011200212003120041200512006120071200812009120101201112012120131201412015120161201712018120191202012021120221202312024120251202612027120281202912030120311203212033120341203512036120371203812039120401204112042120431204412045120461204712048120491205012051120521205312054120551205612057120581205912060120611206212063120641206512066120671206812069120701207112072120731207412075120761207712078120791208012081120821208312084120851208612087120881208912090120911209212093120941209512096120971209812099121001210112102121031210412105121061210712108121091211012111121121211312114121151211612117121181211912120121211212212123121241212512126121271212812129121301213112132121331213412135121361213712138121391214012141121421214312144121451214612147121481214912150121511215212153121541215512156121571215812159121601216112162121631216412165121661216712168121691217012171121721217312174121751217612177121781217912180121811218212183121841218512186121871218812189121901219112192121931219412195121961219712198121991220012201122021220312204122051220612207122081220912210122111221212213122141221512216122171221812219122201222112222122231222412225122261222712228122291223012231122321223312234122351223612237122381223912240122411224212243122441224512246122471224812249122501225112252122531225412255122561225712258122591226012261122621226312264122651226612267122681226912270122711227212273122741227512276122771227812279122801228112282122831228412285122861228712288122891229012291122921229312294122951229612297122981229912300123011230212303123041230512306123071230812309123101231112312123131231412315123161231712318123191232012321123221232312324123251232612327123281232912330123311233212333123341233512336123371233812339123401234112342123431234412345123461234712348123491235012351123521235312354123551235612357123581235912360123611236212363123641236512366123671236812369123701237112372123731237412375123761237712378123791238012381123821238312384123851238612387123881238912390123911239212393123941239512396123971239812399124001240112402124031240412405124061240712408124091241012411124121241312414124151241612417124181241912420124211242212423124241242512426124271242812429124301243112432124331243412435124361243712438124391244012441124421244312444124451244612447124481244912450124511245212453124541245512456124571245812459124601246112462124631246412465124661246712468124691247012471124721247312474124751247612477124781247912480124811248212483124841248512486124871248812489124901249112492124931249412495124961249712498124991250012501125021250312504125051250612507125081250912510125111251212513125141251512516125171251812519125201252112522125231252412525125261252712528125291253012531125321253312534125351253612537125381253912540125411254212543125441254512546125471254812549125501255112552125531255412555125561255712558125591256012561125621256312564125651256612567125681256912570125711257212573125741257512576125771257812579125801258112582125831258412585125861258712588125891259012591125921259312594125951259612597125981259912600126011260212603126041260512606126071260812609126101261112612126131261412615126161261712618126191262012621126221262312624126251262612627126281262912630126311263212633126341263512636126371263812639126401264112642126431264412645126461264712648126491265012651126521265312654126551265612657126581265912660126611266212663126641266512666126671266812669126701267112672126731267412675126761267712678126791268012681126821268312684126851268612687126881268912690126911269212693126941269512696126971269812699127001270112702127031270412705127061270712708127091271012711127121271312714127151271612717127181271912720127211272212723127241272512726127271272812729127301273112732127331273412735127361273712738127391274012741127421274312744127451274612747127481274912750127511275212753127541275512756127571275812759127601276112762127631276412765127661276712768127691277012771127721277312774127751277612777127781277912780127811278212783127841278512786127871278812789127901279112792127931279412795127961279712798127991280012801128021280312804128051280612807128081280912810128111281212813128141281512816128171281812819128201282112822128231282412825128261282712828128291283012831128321283312834128351283612837128381283912840128411284212843128441284512846128471284812849128501285112852128531285412855128561285712858128591286012861128621286312864128651286612867128681286912870128711287212873128741287512876128771287812879128801288112882128831288412885128861288712888128891289012891128921289312894128951289612897128981289912900129011290212903129041290512906129071290812909129101291112912129131291412915129161291712918129191292012921129221292312924129251292612927129281292912930129311293212933129341293512936129371293812939129401294112942129431294412945129461294712948129491295012951129521295312954129551295612957129581295912960129611296212963129641296512966129671296812969129701297112972129731297412975129761297712978129791298012981129821298312984129851298612987129881298912990129911299212993129941299512996129971299812999130001300113002130031300413005130061300713008130091301013011130121301313014130151301613017130181301913020130211302213023130241302513026130271302813029130301303113032130331303413035130361303713038130391304013041130421304313044130451304613047130481304913050130511305213053130541305513056130571305813059130601306113062130631306413065130661306713068130691307013071130721307313074130751307613077130781307913080130811308213083130841308513086130871308813089130901309113092130931309413095130961309713098130991310013101131021310313104131051310613107131081310913110131111311213113131141311513116131171311813119131201312113122131231312413125131261312713128131291313013131131321313313134131351313613137131381313913140131411314213143131441314513146131471314813149131501315113152131531315413155131561315713158131591316013161131621316313164131651316613167131681316913170131711317213173131741317513176131771317813179131801318113182131831318413185131861318713188131891319013191131921319313194131951319613197131981319913200132011320213203132041320513206132071320813209132101321113212132131321413215132161321713218132191322013221132221322313224132251322613227132281322913230132311323213233132341323513236132371323813239132401324113242132431324413245132461324713248132491325013251132521325313254132551325613257132581325913260132611326213263132641326513266132671326813269132701327113272132731327413275132761327713278132791328013281132821328313284132851328613287132881328913290132911329213293132941329513296132971329813299133001330113302133031330413305133061330713308133091331013311133121331313314133151331613317133181331913320133211332213323133241332513326133271332813329133301333113332133331333413335133361333713338133391334013341133421334313344133451334613347133481334913350133511335213353133541335513356133571335813359133601336113362133631336413365133661336713368133691337013371133721337313374133751337613377133781337913380133811338213383133841338513386133871338813389133901339113392133931339413395133961339713398133991340013401134021340313404134051340613407134081340913410134111341213413134141341513416134171341813419134201342113422134231342413425134261342713428134291343013431134321343313434134351343613437134381343913440134411344213443134441344513446134471344813449134501345113452134531345413455134561345713458134591346013461134621346313464134651346613467134681346913470134711347213473134741347513476134771347813479134801348113482134831348413485134861348713488134891349013491134921349313494134951349613497134981349913500135011350213503135041350513506135071350813509135101351113512135131351413515135161351713518135191352013521135221352313524135251352613527135281352913530135311353213533135341353513536135371353813539135401354113542135431354413545135461354713548135491355013551135521355313554135551355613557135581355913560135611356213563135641356513566135671356813569135701357113572135731357413575135761357713578135791358013581135821358313584135851358613587135881358913590135911359213593135941359513596135971359813599136001360113602136031360413605136061360713608136091361013611136121361313614136151361613617136181361913620136211362213623136241362513626136271362813629136301363113632136331363413635136361363713638136391364013641136421364313644136451364613647136481364913650136511365213653136541365513656136571365813659136601366113662136631366413665136661366713668136691367013671136721367313674136751367613677136781367913680136811368213683136841368513686136871368813689136901369113692136931369413695136961369713698136991370013701137021370313704137051370613707137081370913710137111371213713137141371513716137171371813719137201372113722137231372413725137261372713728137291373013731137321373313734137351373613737137381373913740137411374213743137441374513746137471374813749137501375113752137531375413755137561375713758137591376013761137621376313764137651376613767137681376913770137711377213773137741377513776137771377813779137801378113782137831378413785137861378713788137891379013791137921379313794137951379613797137981379913800138011380213803138041380513806138071380813809138101381113812138131381413815138161381713818138191382013821138221382313824138251382613827138281382913830138311383213833138341383513836138371383813839138401384113842138431384413845138461384713848138491385013851138521385313854138551385613857138581385913860138611386213863138641386513866138671386813869138701387113872138731387413875138761387713878138791388013881138821388313884138851388613887138881388913890138911389213893138941389513896138971389813899139001390113902139031390413905139061390713908139091391013911139121391313914139151391613917139181391913920139211392213923139241392513926139271392813929139301393113932139331393413935139361393713938139391394013941139421394313944139451394613947139481394913950139511395213953139541395513956139571395813959139601396113962139631396413965139661396713968139691397013971139721397313974139751397613977139781397913980139811398213983139841398513986139871398813989139901399113992139931399413995139961399713998139991400014001140021400314004140051400614007140081400914010140111401214013140141401514016140171401814019140201402114022140231402414025140261402714028140291403014031140321403314034140351403614037140381403914040140411404214043140441404514046140471404814049140501405114052140531405414055140561405714058140591406014061140621406314064140651406614067140681406914070140711407214073140741407514076140771407814079140801408114082140831408414085140861408714088140891409014091140921409314094140951409614097140981409914100141011410214103141041410514106141071410814109141101411114112141131411414115141161411714118
Next page