Use this single strand of nucleic acid * 5′- ATGCTATCATTGACCTTGAGTTATTAA -3′ * and answer the following: i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding strand of a DNA molecule, what would […]

Q1. Describe oxidative and non-oxidative branches of the pentose phosphate pathway and distinguish between these branches in terms of their roles in producing NADPH for biosynthesis reactions or 5-carbon sugar for mucleic acid synthesis. Q2. How to propose the primers to amplify the Huntington Disease (HD) CAG repeat? Should they […]

This is to be a philosophical discussion… What are the characteristics of life? There are some things, like planets, stars, viruses and prions that have many of the characteristics of life, but are not alive. … How is it that these (or something you’ve researched) come close to being alive, […]

Heat traveling when energy is passed frommolecule to molecule as they bump into each other is called. conductionconvectionthermalradiation 2. When an object such as a spoon or straw is seenin a glass of water it looks broken. This is because. the light passing through different materials at aslant is refracted.lightrays […]