1) An oncogene is a) A viral gene with no relation to the host cell’s genes. b) Absent in human cancer cells. c) A bacterial gene that causes cancer in the host. d) A mutated form of a proto-oncogene e) A gene that turns off cellular reproduction. 2) Apoptosis refers […]
Q1. Recognize the groups of microorganisms included in the scope of microbiology and explain the criteria for including these groups in the field. Q2. A marine biologist has dredge up some unknown animal from the seafloor. Describe some of the characteristics she must look at to determine the animal phylum. […]
1.What toxic substance that has a lethal dose of 2,000 to 5,000 ppm to laboratory animals has been detected in smoke from polymeric fires? __________. Which of the following statements about polymer decomposition and combustion is INCORRECT?The surfaces of some polymeric products tend to char as they burn.Burning polymeric products […]
Use this single strand of nucleic acid * 5′- ATGCTATCATTGACCTTGAGTTATTAA -3′ * and answer the following: i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding strand of a DNA molecule, what would […]