Which of the following is not a feature of prokaryotes? A) DNA is circular B) The nucleus is enveloped with a bilipid layer C) DNA contained in chromosomes D) Discrete organelles E) None of the above 10) What was not a result from the breakup of Pangaea? A) Populations of […]

BIO Problems 1) What is “discovery bias”? is there anything similar in other fields (such as “treatment bias” in medicine or “driving bias” in errand-running)? 2) Does publishing the full methods and results of the Fouchier and Kawaoka H5N1 studies seem likely to increase our ability to protect public health […]

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′A. Where is the trascription start site?B. find TTTACA around -35 region and box it. (my […]

Homo neanderthalis is a species of hominid that is now known to have lived with early Homo sapiens for as long as 35,000 years. As the Neanderthals were specialized to a geographic area, they were not readily adaptable, and ultimately went the way of extinction. However, it is also now […]