Uncategorized

Q1. Imagine there are 25 different species of protists living in a tide pool. Some of the species reproduce both sexually and asexually, and some of them can reproduce only asexually. The pool regularly becomes infested with disease-causing viruses and bacteria. Which species are more possible to thrive in the […]

The following DNA sequence shows a “gene” encoding a smallpolypeptide. The start codon is AUG and the three “stop” codons are UAA, UAG, and UGA. The promoter region of the DNA is inparetntheses. 5′ (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3′3′ (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5′ using the mRNA codon chart, transcribe and translate the”gene” from […]

1) Briefly explain why an acetylcholine antagonist would speed the heart.2) Briefly explain why certain neurons must have glucose availablefor metabolism and which neurons they tend to be.3) Identify the structures from which cerebrospinal fluid isabsorbed into the superior sagittal sinus.4) What pulley-shaped process gives its name to a cranialnerve5) […]

Gene Technology Gene technology carries with it social and ethical implications-many of which engender personal views and discussion. Select one (1) of the following biotechnology topics to write about:  Genetically modified crop plants Genetically modified microorganisms Genetically modified animals Personal genomics and / or personalized medicine for humans Gene therapy […]