Uncategorized

Arnqvist, G., T.M. Jones, and M.A. Elgar (2003) Reversal of sex roles in nuptial feeding. Nature 424: 387. 1) In many species (including some insects, birds, mammals, etc), males provide their mates with food or other resources. In doing so, they help females provide for young, thus enhancing their own […]

Malaria cannot survive well within “partially defective” redblood cells. Thus, heterozygous tend to survive better than eitherof the homozygous conditions. If 9% of a given population is bornwith the severe form of sickle-cell anemia, what percentage of thepopulation will be more resistant to malaria because they areheterozygous for the sickle-cell […]

I. A double strand of DNA contains the following sequence. 5′ AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3′3′ TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5′ a. Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT. b. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame? Please indicate […]

When exposed to light, plant cells show a net absorption of CO2 and net production of O2. In the dark, they show net production of CO2 and net absorption of O2. a. What biochemical process is responsible for the plants absorption of O2 and net production of CO2? b. Does […]