Write the sequence of the primary rna transcript

What laws and concepts are covered
April 23, 2020
Explain a type of column chromatography
April 23, 2020

Write the sequence of the primary rna transcript

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.

+1 (786) 788-0496
Welcome to brimaxessays.com
Hello 👋
We will write your work from scratch and ensure it's plagiarism-free, you just submit the completed work.