Solution-Which pair has the highest degree of nucleotide

Which of the following preformed mediators of inflammation
April 29, 2020
Color- blindness and normal vision
April 29, 2020

Solution-Which pair has the highest degree of nucleotide

1. Short regions of DNA sequence from four different organisms are shown below.

Organism A         AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC
Organism B         AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC
Organism C         AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC
Organism D         AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC

Here are the same sequences aligned below for you to highlight their differences in sequence:

A) Strictly on the basis of these sequences (i.e. – extent of homology) briefly describe the phylogenetic relationship of these three organisms (i.e – which are the more closely or distantly related)

B) Draw a rooted tree that illustrates your conclusions. (Use Fig. 17.17 in your text and the Phylogenetic Trees animation in the chapter 17 section of iLearn as guides for how to proceed with this part.)

C) Assume that the sequences above were obtained from 16s rRNA genes and that the percent sequence similarity you determined for these short sequences is the same as that for the entire 16s rRNA coding regions. Additionally, assume that: 1) further analysis reveals that several orthologous genes have the same percent similarity that you saw in the SSU analysis and 2) total genomic DNA hybridization analysis reveals the percent similarity shown in the table below. Using the working definition of a species described in section 17.5 of the class textbook (3rd edition) and the guidelines in Figure 1 below, complete the table below. NOTE: the guidelines in the textbook are more up-to-date and take more factors into consideration than the guidelines in Figure 1, which are based solely on DNA hybridization data. Therefore, the guidelines in section 17.5 should take preference in cases where the two methods lead to alternative results.

 

 

% similarity(DNA hybridization)

Same genus?

Same species?

Organisms A and D

20

Organisms C and D

79

Organisms B and D

71

D) Based on the data in part C above:

i) Which pair of organisms would you expect to have the highest degree of nucleotide similarity in theirinformational genes (as discussed in section 17.3)?

ii) Which pair has the highest degree of nucleotide similarity in their operational genes?

2. The purple phototrophic bacteria and the cyanobacteria can both generate energy by photosynthesis but differ physiologically and ecologically in the way they do it. Which of these two photosynthetic organisms has remained more metabolically and ecologically similar to their last common ancestor? Explain the reasoning behind your answer.

3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. In addition to thenucleus, eukaryotes contain a number of subcellular membrane-enclosed organelles in the cytoplasmincluding, the endoplasmic reticulum, the Golgi, endosomes, hydrogenosomes, lysosomes,mitochondria, peroxisomes and, in photosynthetic organisms, chloroplasts. Additionally, eukaryotic cells also contain transport vesicles that move cargo among particular organelles and secretory vesicles that deliver cargo to the cytoplasmic membrane.

For each of the proteins below, list all of the subcellular organelles (indicated in bold type above) involved in its expression and targeting. For example, for the expression of a cytoplasmic protein, the mRNA for the gene encoding it is transcribed in the nucleus and transported to the cytoplasm where the protein is translated and released, so an appropriate answer would be: nucleus and cytoplasm. The material in your textbook’s appendix A2.4 should be helpful in answering these following questions.

A. a protein that is secreted from the cell

2. a lysosomal protein
3. a nuclear protein
4. the envelope glycoprotein (env) of HIV-1

In which compartments do the following processes occur?
5. oxidative phosphorylation
6. hydrolysis of macromolecules (such as proteins, fats and carbohydrates) that are taken up from the extracellular space by endocytosis or phagocytosis
7. photosynthesis
8. oxidation of pyruvate
9. transcription
10. glycosylation of proteins
11. sorting of proteins to appropriate organelles such as lysosomes.

+1 (786) 788-0496
Welcome to brimaxessays.com
Hello 👋
We will write your work from scratch and ensure it's plagiarism-free, you just submit the completed work.