Sequence has experienced a spontaneous
Utilize the results from replica-plating to reply
April 11, 2020How numerous chromosomes would be in an egg cell produced
April 11, 2020Sequence has experienced a spontaneous
Assume that the sequence below has experienced a spontaneous
mutation resulting in the tautomeric forms of all of the bases. Further assume that this shifted sequence serves as a template in replication. Write the new sequence of the complementary strand as a result of this shift and identify the type of substitution (if any) for each base on new complementary strand compared to the original complementary strand.
Sequence (5’ TO 3’)
CGGTGTGACACTAGGTAGTCTAACGAGCTCACGGGCAGGGCTATATGTTGCAAAGTCGTAGGTCAC
Complementary sequence (3’ TO 5’)
GCCACACTGTGATCCATCAGATTGCTCGAGTGCCCGTCCGATATACAACGTTTCAGCATCCAGTG
