Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′A. Where is the trascription start site?B. find TTTACA around -35 region and box it. (my […]
Homo neanderthalis is a species of hominid that is now known to have lived with early Homo sapiens for as long as 35,000 years. As the Neanderthals were specialized to a geographic area, they were not readily adaptable, and ultimately went the way of extinction. However, it is also now […]
Imagine a population of 12,000 people: 7,000 females and 5,000 males. Syndrome A is an Xlinked recessive disorder. The population contains 134 affected females, 1682 carrier females and 710 affected males.3A. What is the frequency of the normal allele in the population?3B. What is the frequency of the mutant allele in the […]
1. Identify (list) the two basic types of cells. 2. Would you find proteins inside cells or cells inside proteins? (choose one answer) 3. What two things make osmosis a special type of diffusion? 4. What is a selectively permeable membrane? (Also called a semi-permeable membrane.) 5. Explain what happens […]